DISCOVER-Seq Service Overview
CRISPR-Cas genome editing induces targeted DNA damage but can also affect off-target sites. DISCOVER-Seq* (Discovery of In Situ Cas Off-targets and VERification by sequencing) is an unbiased approach for identifying CRISPR-Cas off-target activity from both in vitro and in vivo samples. Using chromatin immunoprecipitation and next-generation sequencing (ChIP-Seq) it can precisely detect DNA double-stranded breaks, at single base resolution using MRE11, a protein that plays a key role in DNA double-strand break repair.
By capturing DNA sequences bound to this endogenous DNA repair machinery DISCOVER-Seq can be used to monitor repair of Cas-induced double-stranded DNA breaks. The combination of MRE11 ChIP-Seq with custom software (BLENDER - blunt end finder) within the DISCOVER-Seq pipeline is used to determine off-target sequences genome-wide.
DISCOVER-Seq has advantages over other methods currently used for determining off-target activity such as CIRCLE-Seq, SITE-Seq, GUIDE-Seq, and BLISS which all suffer from limitations like the detection of false-positives or the inability to assess the efficiency and safety of gene editing from in vivo samples.
* Beeke Wienert et al., Unbiased detection of CRISPR off-targets in vivo using DISCOVER-Seq.Science 364,286-289(2019).DOI:10.1126/science.aav9023
DISCOVER-Seq Advantages
- Low numbers of false positives
- Can be used for CRISPR-Cas treated in vitro samples like cultured cells and in vivo samples such as patient derived iPS cells and animal models
The DISCOVER-Seq Service includes:
- Chromatin preparation and sonication from cells or tissue
- ChIP with an Active Motif validated MRE11 antibody
- Library preparation
- Next-generation sequencing
- ChIP-Seq Bioinformatics pipeline
- Customized bioinformatics pipeline using BLENDER
- Delivery of data analysis including ranked target and off-target sequences
DISCOVER-Seq Service Data
DISCOVER-Seq was performed on 293T cells expressing CRISPR-Cas9 targeting VEGF with sgRNA GACCCCCTCCACCCCGCCTC, and on control 293T cells expressing CRISPR-Cas9 with non-targeting control (NTC) sgRNA GCTGAAGCACTGCACGCCAT. 8 million cells were fixed with formaldehyde, sheared using the PIXUL® Multi-Sample Sonicator, and prepared for chromatin analysis followed by MRE11 ChIP-Seq. The example provided shows the on-target cut site located at chr6:43,770,475-43,771,208. The NTC DISCOVER-Seq data did not show enrichment at any site.
Figure 1. On-Target CRISPR-Cas9 Site
This genome browser view is centered on the intended CRISPR-Cas9 target site. MRE11, a DNA repair protein, is recruited to double-strand breaks (DSBs) caused by Cas9 activity. Through MRE11 ChIP-Seq, DISCOVER-Seq captures these repair events. A distinct enrichment peak at the cut site confirms successful Cas9 cleavage.
Figure 2. Off-target CRISPR-Cas9 Site
This genome browser view highlights an unintended genomic site where MRE11 binding reveals off-target Cas9 activity. Although this region (e.g., on chr9) was not the intended target, the MRE11 signal indicates Cas9 still introduced a cut. DISCOVER-Seq detects such off-target events without relying on sequence prediction, enabling unbiased and comprehensive off-target profiling. This improves the accuracy and safety of genome-editing assessments.
Figure 3. Off-target discovery using DISCOVER-Seq
The table above shows off-target discovery using DISCOVER-Seq with rows showing nucleotide differences from the target sequence at the top. On the right are columns showing the following: DISCOVER Score which correlates with the number of off-targets, Mismatches which is the number of mismatched bases, and Coordinates which is the location of the sequence in the genome. The table was created using the bioinformatics pipeline BLENDER (BLunt END findER) along with the gRNA guide sequence and the MRE11 ChIP-Seq bam files to identify the beginning and ends of all reads. These locations were examined for putative cut sites by identifying characteristic stacks of reads starting and ending at the same nucleotide and then looking for the adjacent PAM (protospacer adjacent motif, NGG). For all loci with a valid PAM, BLENDER calculated a DISCOVER score by summing up the read ends in a 10 bp window around the cut site.
DISCOVER-Seq Service Documents
DISCOVER-Seq Service Sample Submission Portal
Our online sample submission portal allows you to easily upload your service project samples and track your project status. Follow the sample submission instructions in the portal to ensure that all your samples arrive at Active Motif in the best possible condition and properly associated with your project.
You might also be interested in:
| Name | Cat No. | Price | |
|---|---|---|---|
| DISCOVER-Seq Service | 25203 | Get Quote |




