Active Motif,
Tools to analyze nuclear function,
Your CartYour Cart 0 items
重组蛋白 & 酶

RNA Methylation

make the most of your m6A RNA methylation assays

N6-methylated adenine (m6A) is prevalent in nearly all RNA types and in all organisms from bacteria to humans, and plays an important role in the efficiency of mRNA splicing, processing, translation efficiency, editing and mRNA stability. Active Motif manufactures high-quality, assay-validated Recombinant Proteins for m6A RNA Methylation research, as well as antibodies, Assay Kits and reagents for analysis of RNA modifications.

MTase-Glo assay for METTL3/METTL4 Complex m6A methyltransferase activity

MTase-Glo assay for METTL3 / METTL14 Complex m6A Methyltransferase Activity

1 μM Substrate RNA (UAGAGGACCAGUCGGACCAGUCGGACCGAU) and 1 μM SAM was incubated with different concentrations of METTL3 / METTL14 Complex (Cat. No. 31570) in an 8 μl reaction system containing 50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2, and 1 mM TCEP at room temperature for 1 hour (0.2 U/μl RRI was added in this system). 5xMTase-Glo Reagent was added to the products and incubated for 30 min. Then MTase-Glo Detection was added and luminescence were read after another 30 min incubation. An SAH standard curve (0-1 μM) was performed following the same protocol.

Name Expressed In Format Cat No. Price  
Recombinant ALKBH2 protein E. coli 100 µg 81129 ¥3,425.50 Buy Now
1 mg 81829 ¥21,762 Buy Now
Recombinant ALKBH3 protein E. coli 100 µg 81130 ¥3,425.50 Buy Now
1 mg 81830 ¥21,762 Buy Now
Recombinant ALKBH4 protein E. coli 100 µg 81131 ¥3,425.50 Buy Now
1 mg 81831 ¥21,762 Buy Now
Recombinant ALKBH5 protein Baculovirus 20 µg 31589 ¥3,465.80 Buy Now
Recombinant ALKBH6 protein E. coli 50 µg 81191 ¥3,425.50 Buy Now
1 mg 81891 ¥21,762 Buy Now
Recombinant ALKBH7 protein E. coli 100 µg 81132 ¥3,425.50 Buy Now
1 mg 81832 ¥21,762 Buy Now
Recombinant ALKBH8 protein E. coli 100 µg 81197 ¥3,425.50 Buy Now
1 mg 81797 ¥21,762 Buy Now
Recombinant FTO protein Baculovirus 20 µg 31572 ¥3,425.50 Buy Now
1 mg 31972 ¥29,016 Buy Now
Recombinant FTSJ3 protein Baculovirus 20 µg 81189 ¥3,304.60 Buy Now
1 mg 81889 ¥28,210 Buy Now
Recombinant METTL1 protein Baculovirus 20 µg 81022 ¥3,344.90 Buy Now
Recombinant METTL1 protein, GST-Tag E. coli 100 µg 81059 ¥3,344.90 Buy Now
1 mg 81759 ¥21,762 Buy Now
Recombinant METTL1 protein, His-Tag E. coli 100 µg 81058 ¥3,344.90 Buy Now
1 mg 81758 ¥21,762 Buy Now
Recombinant METTL2A protein Baculovirus 20 µg 81027 ¥3,344.90 Buy Now
Recombinant METTL3 protein Baculovirus 20 µg 31567 ¥3,627 Buy Now
Recombinant METTL3 / METTL14 complex Baculovirus 20 µg 31570 ¥3,828.50 Buy Now
Recombinant METTL4 protein Baculovirus 10 µg 81177 ¥3,344.90 Buy Now
1 mg 81877 ¥47,554 Buy Now
Recombinant METTL6 protein Baculovirus 20 µg 81023 ¥3,344.90 Buy Now
Recombinant METTL6 protein, GST-Tag E. coli 100 µg 81061 ¥3,264.30 Buy Now
1 mg 81761 ¥21,762 Buy Now
Recombinant METTL6 protein, His-Tag E. coli 100 µg 81060 ¥3,344.90 Buy Now
1 mg 81760 ¥21,762 Buy Now
Recombinant METTL7A protein Baculovirus 10 µg 81178 ¥3,344.90 Buy Now
1 mg 81878 ¥47,554 Buy Now
Recombinant METTL8 protein Baculovirus 20 µg 81028 ¥3,344.90 Buy Now
Recombinant METTL8 protein, GST-Tag E. coli 50 µg 81106 ¥3,264.30 Buy Now
1 mg 81806 ¥21,762 Buy Now
Recombinant METTL11A (NTMT1) protein Baculovirus 20 µg 81029 ¥3,264.30 Buy Now
1 mg 81729 ¥29,016 Buy Now
Recombinant METTL11A (NTMT1) protein, His-Tag E. coli 100 µg 81062 ¥3,344.90 Buy Now
1 mg 81762 ¥21,762 Buy Now
Recombinant METTL11B (NTM1B) protein E. coli 50 µg 81121 ¥3,264.30 Buy Now
1 mg 81821 ¥21,762 Buy Now
Recombinant METTL13 protein Baculovirus 20 µg 81024 ¥3,344.90 Buy Now
Recombinant METTL14 protein Baculovirus 20 µg 31568 ¥3,344.90 Buy Now
Recombinant METTL15 protein Baculovirus 20 µg 81084 ¥3,264.30 Buy Now
1 mg 81784 ¥29,016 Buy Now
Recombinant METTL16 protein Baculovirus 20 µg 81085 ¥3,264.30 Buy Now
1 mg 81785 ¥29,016 Buy Now
Recombinant METTL17 protein Baculovirus 10 µg 81105 ¥3,344.90 Buy Now
1 mg 81805 ¥47,554 Buy Now
Recombinant METTL18 protein Baculovirus 20 µg 81030 ¥3,344.90 Buy Now
Recombinant METTL19 (TRMT44) protein Baculovirus 20 µg 81088 ¥3,264.30 Buy Now
1 mg 81788 ¥29,016 Buy Now
Recombinant METTL21A protein E. coli 100 µg 81122 ¥3,344.90 Buy Now
1 mg 81822 ¥21,762 Buy Now
Recombinant METTL21C protein E. coli 50 µg 81123 ¥3,264.30 Buy Now
1 mg 81823 ¥21,762 Buy Now
Recombinant METTL22 protein Baculovirus 20 µg 81092 ¥3,344.90 Buy Now
1 mg 81892 ¥29,016 Buy Now
Recombinant METTL25 protein Baculovirus 20 µg 81089 ¥3,264.30 Buy Now
1 mg 81789 ¥29,016 Buy Now
Recombinant METTL26 (JFP2) protein E. coli 100 µg 81063 ¥3,344.90 Buy Now
1 mg 81763 ¥21,762 Buy Now
Recombinant NSUN1 protein Baculovirus 20 µg 81170 ¥3,304.60 Buy Now
1 mg 81870 ¥28,210 Buy Now
Recombinant NSUN2 protein Baculovirus 20 µg 81171 ¥3,304.60 Buy Now
1 mg 81871 ¥28,210 Buy Now
Recombinant NSUN3 protein Baculovirus 20 µg 81183 ¥3,304.60 Buy Now
Recombinant NSUN4 (SHTAP) protein Baculovirus 20 µg 81172 ¥3,304.60 Buy Now
1 mg 81872 ¥28,210 Buy Now
Recombinant NSUN5 protein Baculovirus 20 µg 81173 ¥3,304.60 Buy Now
1 mg 81873 ¥28,210 Buy Now
Recombinant NSUN6 protein Baculovirus 20 µg 81174 ¥3,304.60 Buy Now
1 mg 81874 ¥28,210 Buy Now
Recombinant NSUN7 protein Baculovirus 10 µg 81175 ¥3,304.60 Buy Now
Recombinant WTAP protein Baculovirus 20 µg 31571 ¥3,385.20 Buy Now
Recombinant YTHDC2 (1279-1429) protein E. coli 100 µg 81101 ¥3,344.90 Buy Now
1 mg 81801 ¥20,956 Buy Now
Recombinant YTHDC2 protein Baculovirus 20 µg 81198 ¥3,304.60 Buy Now
Recombinant YTHDF1 protein Baculovirus 20 µg 31608 ¥3,304.60 Buy Now
Recombinant YTHDF1 (380-533) protein E. coli 100 µg 81102 ¥3,344.90 Buy Now
1 mg 81802 ¥20,956 Buy Now
Recombinant YTHDF2 protein Baculovirus 20 µg 31573 ¥3,344.90 Buy Now
Recombinant YTHDF2 (401-554) protein E. coli 100 µg 81103 ¥3,344.90 Buy Now
1 mg 81803 ¥20,956 Buy Now
Recombinant YTHDF3 (407-560) protein E. coli 100 µg 81104 ¥3,344.90 Buy Now
1 mg 81804 ¥20,956 Buy Now